01-01-2019
English

contestada

Name the 3 continents and oceans in the world and describe it Name 1 special planet which is not there

Respuesta :

ibihamlincon2005 ibihamlincon2005

01-01-2019

3 Continents are Asia, Africa and Europe.

3 Oceans are South Pacific Ocean, Indian Ocean and Atlantic Ocean.

Not sure what you mean about the plant part.

Answer Link

Otras preguntas

Is the function f(x) = x3 - x2 - 1 even, odd, or neither?

how old do you have to be to work at baskin-robbins

Which is the correct statement

describe how two sumerian accomplishments influenced later peoples

Which is particle 1) has mass, but the lowest mass ever detected, 2) has no electric charge, 3) has the lowest probability of interacting with the electrons/neu

accounts receivable are typically classified as current assets because:

Hi can someone help me with question and how you got the answer? thanks :)

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Give some examples of climate change.

Write a sentence using a demonstrative pronoun (label)