WolfLily
WolfLily WolfLily
  • 01-08-2019
  • Mathematics
contestada

Can someone help me please?!?

Can someone help me please class=

Respuesta :

kosala1478
kosala1478 kosala1478
  • 01-08-2019

Answer:

k=10

Step-by-step explanation:

g(x)=2x^2+ kx+18

when x=-2

g(-2)=2 (-2)^2 -2k +18

Since when x is -2, y =6

6=2 (-2)^2 -2k +18

6=18+8-2k

2k=26-6

2k=20

k=10

Answer Link

Otras preguntas

Charles owns a hardware store. He put hammers and nails on sale last weekend. His first customer bought 3 hammers and 16 nails for $22.96. His last customer bou
How would I solve this?
Under negligence, the defendant has the duty to act like:__________. a. A specialist trained in the area of the accident. b. An ordinary, prudent, and reasonabl
What is a common noun of George Washington
which monarchs of 1500-1800 had trouble with rebellions?
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
calculate the mean 3,2,2,2,86
Micah run the 200 yards hurdles with the track team the last hurdle is placed exactly 34 feet from the finish line how far will Micah run from the starting line
A spring with spring constant of 33 N/m is stretched 0.15 m from its equilibrium position. How much work must be done to stretch it an additional 0.072 m? 1. 0.
Help ASAP ! Show work