crazytechnolgy701 crazytechnolgy701

03-01-2020
Spanish

contestada

how would you ask politely for a beverage

Respuesta :

gabriella0515 gabriella0515

03-01-2020

May I please have ( your drink of choice )

Answer Link

baddieitems baddieitems

03-01-2020

Answer:puedo coher una soda porfavor

Explanation:

Answer Link

Otras preguntas

pls helppp! i don’t understand:|

the total length is 3.48 m so how many pieces to i need to add to get 8m?

Tell a story that integrates all/each of the vocabulary terms below. you must use the words in correct way. PLZZZZ HELP

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Can someone please help me with 15855 divided by 35? Pls and Ty

Please explain how you get the answer to... a+2a+7+4a-8

to print a square of star shaoe we use the following code: A. cout<<“****”; B. cout<<“****\n”; C. cout<<****;

what do you call the spot where your shooting hand consistently comes to a normal rest on or near your face?

Help plzzzz Which of the following best describes the difference between a scientific theory and theories from other bodies of knowledge? A.) Scientific theori

Can someone help me plss tyy!