jacobkmartin1810 jacobkmartin1810
  • 01-04-2020
  • Mathematics
contestada

You drive 390 miles in 6 hours

Respuesta :

zaniya1244
zaniya1244 zaniya1244
  • 01-04-2020

Answer:

65

Step-by-step explanation:

divide 390 by 6

Answer Link

Otras preguntas

need help anybody know how to do this
what is the smallest unit that can evolve
Which expression is a difference? a.(6 - 4) x 5 b.6 - (4 x 5) c.8 + (5 - 2) d.(6 - 4)(3 - 1)?
A guitarist uses ________ to recall how to play the notes of a specific song. episodic memory procedural memory semantic memory a flashbulb memory
Find the missing length indicated
Write one or two sentences about the main idea or purpose of the article.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A box contains 3 plain pencils and 5 pens. A second box contains 6 color pencils and 2 crayons. One item from each box is chosen at random. What is the probabil
please answer this im dying here
Which of the following has 20 faces? A. Tetrahedron B. Dodecahedron C. Octahedron D. Icosahedron