01-11-2020
Mathematics

contestada

Whats 2,000 − 1,867.85

Respuesta :

Аноним Аноним

01-11-2020

Answer:

132.15

Step-by-step Explanation:

Hope this helps! Please consider marking brainliest!

Answer Link

Otras preguntas

Need help ASAP !!!!!!!

The striton family had a meal catered for a wedding rehearsal dinner. The cost of the dinner was $476. There was a 5% sales tax and they left a 15% tip. What wa

How many neutrons does element X have if its atomic number is 31 and its mass number is 90?

The national competency-based credential for entry-level early childhood educators is called?

If the points (-2, 2), (-4, 4), (2, -2), and (4, -4) are joined to form a straight line, at what point does the line intersect the y-axis

What value is added to both sides of the equation x2 − 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2

Katy invests a total of $26,500 in two accounts paying 4% and 9% annual interest, respectively. How much was invested in each account if, after one year, the to

For how many different values of θ between 0 and 2π radians is sec x = csc x ?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which one of the following will likely be revealed in the inspection report? A. school attendance zone B. termite damage C. age of the property D. liens