kcuda kcuda
  • 03-11-2020
  • Mathematics
contestada

Given that AD is the perpendicular bisector of BC, AB=21.3, AC=21.3, and DC=9.1, identify BC.

a) BC = 42.6
b) BC = 18.2
c) BC = 9.1
d) BC = 4.55

sorry i can't upload a picture of the triangle but this is from an luoa assignment. i know it's not C

Respuesta :

camdenjohnsondsm camdenjohnsondsm
  • 16-11-2020

answer. B hope this helps

Answer Link

Otras preguntas

Round 46.895 to the nearest tenth
what rule does static electricity follow
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
Why were the committees of correspondence powerful?
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How did the mountains in Greece contribute to the rise of city-states?