Seudónimo Seudónimo
  • 04-11-2020
  • English
contestada

Write all the words in alphabetical order

Write all the words in alphabetical order class=

Respuesta :

jaderose51529
jaderose51529 jaderose51529
  • 04-11-2020

Answer:

Dad, deliver, diaper, donkey, dust

Explanation:

Answer Link
alexia926aeh
alexia926aeh alexia926aeh
  • 04-11-2020

Answer:

dad, deliver, diaper, donkey, dust

Explanation:

Answer Link

Otras preguntas

Which option would best fit in this diagram in the bubble labeled 1?
What are some quotes in macbeth that show he is ambitious?
Which of the following have at least two congruent parallel bases? all that apply. A. Cylinder B. Circle C. Cone D. Cube E. None of these F
what are good websites to study for biology?
Joan is 5 years older than ellen, and 3 years ago the sum of their ages was 17 years. in how many years will joan be 21 years old?
Pls answer this question
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Isabelle has been forgetting a lot of things lately, and her friends and family have been angry with her. Today, she feels as if she's going to do something wr
During the song dynasty, the chinese economy expanded because question 19 options: new fishing methods created a surplus of food. song warriors destroyed the mo
I need help with this problem!