padillaemilia176 padillaemilia176

04-03-2021
Mathematics

contestada

Is 63.90 greater than 63.990

Respuesta :

bistanish150 bistanish150

04-03-2021

Answer:

63.90 is greater than63.990

Answer Link

BNHA0FREAK BNHA0FREAK

04-03-2021

(ﾉ◕ヮ◕)ﾉ*:･ﾟ✧ ✧ﾟ･: *ヽ(◕ヮ◕ヽ)

Hello!

No 63.90 is not greater than 63.990

(I fixed this)

Answer Link

Otras preguntas

What does the word “advertise” mean as used in line 4? I’m nobody who are you

Read the sentences from the "Ellis Island Oral History Project" excerpt. When we got on the Rotterdam, we had a field day. One, I was never on ship before and i

Really Confused Please Help me Up to 20+ Brain points A Through B

Access Organics, Inc., hired Andy Hernandez to sell organic produce. Later, Hernandez signed an agreement not to compete with Access for two years following the

You are studying body color in an African spider and have found that it is controlled by a single gene with four alleles: B (brown), br (red), bg (green), and b

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Mimicry is an resemblance between an organism and another object and they advantages are???

what is the equation of the line through the origin and (-4,-9)

What is 6 plus 6 and times 4 plus 8

Camp counselor and six campers are to be seated along a picnic bench. In how many ways can this be done if the counselor must be seated in the middle and a camp