39017769
39017769 39017769
  • 04-05-2021
  • Mathematics
contestada

Will get brainlyest!!!!!!! answer has to be in radical form if irrational

Will get brainlyest answer has to be in radical form if irrational class=

Respuesta :

sanjibdas5930
sanjibdas5930 sanjibdas5930
  • 15-05-2021

x = -1.9/2.1

x = -0.9047619048

As the number or the magnitude of x is a terminating decimal number so it is not irrational number its a rational number

Hope it helps

Answer Link

Otras preguntas

f(x) = -3(x - 1)2 + 6 in standard form
1.How can media help in conflict management​
HELP PLEASE I WILL GIVE RAINLIST
On 20th February 1947 British prime minister made a statement thatHis majesty's government was will to hand over power to responsibleIndian hands up till June 1
Flexibility exercise can be done everyday. True or false
Please answer! I’ll give branliest! This is needed by tomorrow! Answers would be appreciated!
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
1.Dylan drew 1 heart, 1 star, and 26 circles. What is the ratio of circles to hearts? A.1 : 26B.1 : 1 : 26C.26 : 1 : 1D.26 : 12.Your school has 90 teachers and
Round your answer to the nearest hundredth. ? с А 3 70° B
Profit/loss/BE Supporting calculation Business А Revenue TR = £350000 Costs TC = £270000 B £10 price 50000 units sold TC = £560000 I с TR = 180000 FC = £100000