isabelbean200649 isabelbean200649

01-10-2021
Mathematics

contestada

The expression 10 – 8 is the amount by which

10 exceeds 8.
8 exceeds 2.
10 is less than 8.
8 is less than 2.

Respuesta :

rifrie322 rifrie322

01-10-2021

The answer is 10 exceeds 8.

Answer Link

Otras preguntas

A group of people were asked if they had run a red light in the last year. 250 responded "yes", and 450 responded "no". Find the probability that if a person is

Read the following paragraph. Keeping my mind on my writing is not easy when I stay at my grandmother's ocean-side cottage. Just about the time that I am going

Let's Check In What was Gen Mobutu Sese Seko's European name? A Edward Sese Seko 3. Chris Sese Seko Joseph Mobutu D. David Mobutu Please select the best answer

Rowan has two pieces of cable, one 15 feet long and the other 12 feet long. For a science project he wants to cut them up to produces pieces of cable that are a

how is an organisms success determined by its environment?

ㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤ

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

What is some of the evidence for speed at which glaciers are melting

Use the figure to complete the statements, Triangle 1 is the image of triangle 2 reflected over the Triangle 2 is the image of triangle 3 reflected over the Ref

- 2x – 3 = 15 What is the answer