ohiolily ohiolily
  • 03-03-2022
  • English
contestada

Question 1 of 10
An outline is used to _____thoughts and ideas.
O A. organize
B. research
C. come up with
D. edit

Respuesta :

k8w
k8w k8w
  • 03-03-2022

Answer:

A Organize

Explanation:

Im sorry if im wrong but hope this helps!!

Answer Link

Otras preguntas

For some time, the English had little interest in colonizing for what two reasons?
Your religious identity is only important for you within your family and does not matter in the public sphere.
stars and planets are made from gases in a
I know you would not mind if we could fight and wrest the scepter from your hands. you know that we are powerless to do that, for you have ensured our incapacit
Identify the consequences—both long-term and short-term—of the vietnam war.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
please help if you know, thanks!
What is foster’s overall point about journeys or trips in literature?
If a car's __________ is malfunctioning, people in the car will become ill when driving long distances, especially if the windows are closed. A. braking system
i will mark as brainiest you answer this easy question