whitek422 whitek422

04-03-2022
Spanish

contestada

Escucha y elige. Listen to the descriptions and circle the adjective you hear
in each sentence

Escucha y elige Listen to the descriptions and circle the adjective you hear in each sentence class=

Respuesta :

LovelyQuuen LovelyQuuen

04-03-2022

2 , C and i think that is the answer.

Answer Link

valeriesings valeriesings

05-03-2022

pretty sure it’s 2 C :)

Answer Link

Otras preguntas

The type and age of rocks found in the mountain range are also found on another continent. What might this mean?

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?

In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t

Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.

lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti

Please answer theses division problems!! 9 divided by 3/7

a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.

i need help with this question

The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the