04-05-2022
Mathematics

contestada

help pls, thank you !!

help pls thank you class=

Respuesta :

Andrafonia Andrafonia

06-05-2022

Answer:

the first one is a lie

Step-by-step explanation:

caf is more 45 degrees than 25

Answer Link

Otras preguntas

You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome

Solve the equation by the method of your choice. StartFraction 1 Over x EndFraction plus StartFraction 1 Over x plus 4 EndFraction equals one half The solution

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

zimmerman note definition

Firms can use one, no more than two, of five entry modes to enter into international markets. Exporting, Licensing, Strategic Alliances, Acquisitions, and newly

The length of a rectangular garden is 4 m greater than the width. the area of the garden is nbsp 60m squared . find the dimensions of the garden.

Sugar melts at 367°F. What is the melting point of sugar on the Celsius scale?

Identify the vertical asymptote(s) of each function. Check all of the boxes that apply. f(x)=3x/x^2-16 Answers: x = -16 x = -4 x = 0 x = 4 x = 16

What is [tex] \frac{1}{x+2} +\frac{6}{x-5} [/tex] equal to?Please show most of your work!!!Thank you!!

What was a major effect of the agricultural revolution in the united states during the late 1800's?