Grosephleycoo Grosephleycoo
  • 04-02-2017
  • Mathematics
contestada

Sarah bought a toaster for 75 dollars. that is 1/4 the listed price. what is the original listed price

Respuesta :

Аноним Аноним
  • 11-02-2017
Let, the Original Price = x
x * 1/4 = 75
x = 75 * 4
x = 300

In short, Your Answer would be $300

Hope this helps!
Answer Link

Otras preguntas

Which word has the long i sound? relieve speciality society social
Which body tissue or organ contains the most mitochondria?
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
What was religion like in Shang China?
How do you write fifty-seven thousand,eighteen. In standard form
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.