givigivi122
givigivi122 givigivi122
  • 01-03-2017
  • Mathematics
contestada

What is 3 1/2- 2/7
^ ^
fractions

Respuesta :

Аноним Аноним
  • 01-03-2017
45/15 which equals 3 3/14 as a mixed number
Answer Link

Otras preguntas

g An object spins in place with no unbalanced forces or torques acting upon it, what do we expect this object to do? The object’s spin will slow and eventually
find missing angle..x=??
Which inequality represents the graph below
425/3333 is it. A rational number
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
A distant large asteroid is detected that might pose a threat to Earth. If it were to continue moving in a straight line at constant speed, it would pass 24000
Why Lincoln had to go into disguise and trade trains as he headed to Washington D.C? (What was he afraid of?)
a club put its members into 5 groups for an activity. After 7 student have to leave early, there are only 3 students left to finish the activity. How many stude
The electric field of a charge Q at a distance d away is measured as E What will the electric field measure at a distance 1/2 d away from the charge?
The monthly cost of a certain long distance service is given by the linear function y=0.08x+ 8.95 where Y is in dollars and X is the amount of time in minutes c