georgeszkred georgeszkred
  • 04-06-2014
  • History
contestada

what other areas did the french explorers find 

Respuesta :

alexbratu97 alexbratu97
  • 04-06-2014
Port Royal(1605), Quebec(1608) , Missouri , Lake Champlain
Answer Link
venkatraya
venkatraya venkatraya
  • 04-06-2014
the other areas explored by french explorers are missouri,lakechamplain
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
Fossils are most commonly found in which type of rock?
does a human body use neon???
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
31+34=90-n 45+1=70-k 6×9=41+m
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take